Top » Catalog » SNPs » FT81015

$18.00

FT81015
[FT81015]

FT81015
hg38 Position: ChrY:20638905..20638905
Ancestral: A
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: FT81015_F CTTAAATTTATTGAGCCACCTCTGG
Reverse Primer: FT81015_R GCATGGTGGCTCACACTTG
Reviews

Customers who bought this product also purchased
FT80854
FT80854
A13252
A13252
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies