Top » Catalog » SNPs » A4679

$18.00

A4679
[A4679]

A4679
hg38 Position: ChrY:3023708..3023708
Ancestral: G
Derived: C
Reference: Paul Towne (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A4679_F TGTTTACGGAGGGCTAGGG
Reverse Primer: A4679_R AACACTACAGGAGGGGGAAG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
S228
S228
Z697
Z697
Z196
Z196
DF17
DF17
Y19596
Y19596
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies