Top » Catalog » SNPs » FGC71911

$18.00

FGC71911
[FGC71911]

FGC71911
hg38 Position: ChrY:8209111..8209111
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: E1b
Comments: Below M34 > Y14899
Forward Primer: FGC71911_F AGCTTCAGCCCTTAAGGAATG
Reverse Primer: FGC71911_R GAAATAAGCTGCTGCCTTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies