Top » Catalog » SNPs » A25204

$18.00

A25204
[A25204]

A25204
hg38 Position: ChrY:13776736..13776736
Ancestral: T
Derived: C
Reference: YSEQ (2019)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A25204_F GCAATATTCAGGTGGGAGTGG
Reverse Primer: A25204_R GACAAAAAACCAAACACCCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies