Top » Catalog » SNPs » Z45474

$18.00

Z45474
[Z45474]

Z45474
hg38 Position: ChrY:8951497..8951497
Ancestral: C
Derived: T
Reference: Ray Banks (2017)
ISOGG Haplogroup: G
Comments: Equiv to BY27899
Forward Primer: Z45474_F GTTGATAAAATTTATTGGTGACAAAGATAAG
Reverse Primer: Z45474_R GGTTCCATCAATCACAAGTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies