Top » Catalog » SNPs » ZS1488

$19.00

ZS1488
[ZS1488]

ZS1488
hg38 Position: ChrY:8721060..8721060
Ancestral: G
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample 227455; downstream FGC8223
Forward Primer: ZS1488_F GATCCAGGAAACCCTATGTCG
Reverse Primer: ZS1488_R CATGCCGAAACCACAAGC
Reviews

Customers who bought this product also purchased
YSC0000076
YSC0000076
ZS6059
ZS6059
FGC1707
FGC1707
FGC8214
FGC8214
L858
L858
ZS4346
ZS4346
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies