Top » Catalog » SNPs » A25193

$18.00

A25193
[A25193]

A25193
hg38 Position: ChrY:15710957..15710957
Ancestral: T
Derived: C
Reference: YSEQ (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A25193_F CGTCTAAACACTGCTTTAGCTCTC
Reverse Primer: A25193_R GCAAGTGCTTAGAGATCTACAAAGG
Reviews

Customers who bought this product also purchased
CTS1211
CTS1211
YP581
YP581
R1a-Z280 Panel
R1a-Z280 Panel
YP951
YP951
YP1018
YP1018
Z91
Z91
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies