Top » Catalog » SNPs » A25193

$18.00

A25193
[A25193]

A25193
hg38 Position: ChrY:15710957..15710957
Ancestral: T
Derived: C
Reference: YSEQ (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A25193_F CGTCTAAACACTGCTTTAGCTCTC
Reverse Primer: A25193_R GCAAGTGCTTAGAGATCTACAAAGG
Reviews

Customers who bought this product also purchased
Y2395
Y2395
YP237
YP237
YP4659
YP4659
L145
L145
Y33
Y33
YP979
YP979
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies