Top » Catalog » SNPs » CTS6867

$18.00

CTS6867
[CTS6867]

CTS6867
hg38 Position: ChrY:15045834..15045834
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > Z33 > CTS7352
Forward Primer: CTS6867_F TTAGGTGGTTATATGCTTTGGCTAC
Reverse Primer: CTS6867_R AAGAGGGAAACAAGATGAGATGTAG
Reviews

Customers who bought this product also purchased
BY31338
BY31338
Y152276
Y152276
CTS3552
CTS3552
R1b-PH137 Segregation Panel
R1b-PH137 Segregation Panel
CTS11533
CTS11533
BY31331
BY31331
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies