Top » Catalog » SNPs » CTS6867

$18.00

CTS6867
[CTS6867]

CTS6867
hg38 Position: ChrY:15045834..15045834
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > Z33 > CTS7352
Forward Primer: CTS6867_F TTAGGTGGTTATATGCTTTGGCTAC
Reverse Primer: CTS6867_R AAGAGGGAAACAAGATGAGATGTAG
Reviews

Customers who bought this product also purchased
CTS4451
CTS4451
A25057
A25057
F26162
F26162
BY31338
BY31338
Y152276
Y152276
CTS3552
CTS3552
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies