Top » Catalog » SNPs » A25057

$18.00

A25057
[A25057]

A25057
hg38 Position: ChrY:15044268..15044268
Ancestral: ins
Derived: del
Reference: Ross Hadley (2019)
ISOGG Haplogroup: R1b
Comments: Below CTS7352. Approx. with PH137
Forward Primer: A25057_F AAAAGTCCTTTGACTAAATTCAACG
Reverse Primer: A25057_R AAAGGTGATGTAATCAAACAGTATGC
Reviews

Customers who bought this product also purchased
BY31326
BY31326
F26162
F26162
BY31350
BY31350
Y152276
Y152276
CTS4451
CTS4451
R1b-PH137 Segregation Panel
R1b-PH137 Segregation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies