Top » Catalog » SNPs » A25057

$18.00

A25057
[A25057]

A25057
hg38 Position: ChrY:15044268..15044268
Ancestral: ins
Derived: del
Reference: Ross Hadley (2019)
ISOGG Haplogroup: R1b
Comments: Below CTS7352. Approx. with PH137
Forward Primer: A25057_F AAAAGTCCTTTGACTAAATTCAACG
Reverse Primer: A25057_R AAAGGTGATGTAATCAAACAGTATGC
Reviews

Customers who bought this product also purchased
CTS11532
CTS11532
BY194812
BY194812
CTS5636
CTS5636
BY31326
BY31326
F26162
F26162
Y152276
Y152276
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies