Top » Catalog » SNPs » A25057

$18.00

A25057
[A25057]

A25057
hg38 Position: ChrY:15044268..15044268
Ancestral: ins
Derived: del
Reference: Ross Hadley (2019)
ISOGG Haplogroup: R1b
Comments: Below CTS7352. Approx. with PH137
Forward Primer: A25057_F AAAAGTCCTTTGACTAAATTCAACG
Reverse Primer: A25057_R AAAGGTGATGTAATCAAACAGTATGC
Reviews

Customers who bought this product also purchased
BY31331
BY31331
Y146181
Y146181
CTS2658
CTS2658
CTS6867
CTS6867
BY31330
BY31330
Y146179
Y146179
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies