Top » Catalog » SNPs » BY194812

$18.00

BY194812
[BY194812]

BY194812
hg38 Position: ChrY:14438874..14438874
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY194812_F TGATGTTCACCTTGATTACTCAGTG
Reverse Primer: BY194812_R TGGGAAAGGCAGATGAACAC
Reviews

Customers who bought this product also purchased
BY31338
BY31338
Y152276
Y152276
CTS4451
CTS4451
R1b-PH137 Segregation Panel
R1b-PH137 Segregation Panel
CTS11533
CTS11533
BY31331
BY31331
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies