Top » Catalog » SNPs » BY194812

$18.00

BY194812
[BY194812]

BY194812
hg38 Position: ChrY:14438874..14438874
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY194812_F TGATGTTCACCTTGATTACTCAGTG
Reverse Primer: BY194812_R TGGGAAAGGCAGATGAACAC
Reviews

Customers who bought this product also purchased
CTS1221
CTS1221
CTS6449
CTS6449
BY31326
BY31326
PH137
PH137
BY31350
BY31350
CTS11532
CTS11532
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies