Top » Catalog » SNPs » BY194812

$18.00

BY194812
[BY194812]

BY194812
hg38 Position: ChrY:14438874..14438874
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY194812_F TGATGTTCACCTTGATTACTCAGTG
Reverse Primer: BY194812_R TGGGAAAGGCAGATGAACAC
Reviews

Customers who bought this product also purchased
BY31331
BY31331
Y146210
Y146210
CTS3552
CTS3552
CTS10051
CTS10051
BY31330
BY31330
Y146181
Y146181
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies