Top » Catalog » SNPs » BY31350

$18.00

BY31350
[BY31350]

BY31350
hg38 Position: ChrY:21468991..21468991
Ancestral: A
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > Z33 > CTS7352
Forward Primer: BY31350_F TGCTCTTGGAGAAGTGTAAGTAACTTAC
Reverse Primer: BY31350_R CCTGAATTAAGGCCTCTTGG
Reviews

Customers who bought this product also purchased
BY31338
BY31338
Y152276
Y152276
CTS4451
CTS4451
R1b-PH137 Segregation Panel
R1b-PH137 Segregation Panel
CTS11533
CTS11533
BY31331
BY31331
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies