Top » Catalog » SNPs » CTS3552

$18.00

CTS3552
[CTS3552]

CTS3552
hg38 Position: ChrY:12895172..12895172
Ancestral: A
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > Z33 > CTS7352
Forward Primer: CTS3552_F CCAAGAGGTCTGACACACTTGAC
Reverse Primer: CTS3552_R ATTAGCATGCTCATCACCTCAC
Reviews

Customers who bought this product also purchased
CTS4451
CTS4451
R1b-PH137 Segregation Panel
R1b-PH137 Segregation Panel
CTS11533
CTS11533
BY31331
BY31331
Y146210
Y146210
CTS2658
CTS2658
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies