Top » Catalog » SNPs » CTS6449

$18.00

CTS6449
[CTS6449]

CTS6449
hg38 Position: ChrY:14793127..14793127
Ancestral: G
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > Z33 > CTS7352
Forward Primer: CTS6449_F CATCTAGCCCTTTTGCTGATG
Reverse Primer: CTS6449_R GTTCTACCATTCTCAGTTGCCA
Reviews

Customers who bought this product also purchased
R1b-PH137 Segregation Panel
R1b-PH137 Segregation Panel
CTS11533
CTS11533
BY31331
BY31331
Y146210
Y146210
CTS2658
CTS2658
CTS10051
CTS10051
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies