Top » Catalog » SNPs » CTS6449

$18.00

CTS6449
[CTS6449]

CTS6449
hg38 Position: ChrY:14793127..14793127
Ancestral: G
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > Z33 > CTS7352
Forward Primer: CTS6449_F CATCTAGCCCTTTTGCTGATG
Reverse Primer: CTS6449_R GTTCTACCATTCTCAGTTGCCA
Reviews

Customers who bought this product also purchased
CTS2658
CTS2658
CTS10051
CTS10051
BY31330
BY31330
Y146181
Y146181
CTS1221
CTS1221
CTS6867
CTS6867
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies