Top » Catalog » SNPs » CTS6449

$18.00

CTS6449
[CTS6449]

CTS6449
hg38 Position: ChrY:14793127..14793127
Ancestral: G
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > Z33 > CTS7352
Forward Primer: CTS6449_F CATCTAGCCCTTTTGCTGATG
Reverse Primer: CTS6449_R GTTCTACCATTCTCAGTTGCCA
Reviews

Customers who bought this product also purchased
CTS5636
CTS5636
BY31326
BY31326
PH137
PH137
BY31350
BY31350
CTS11532
CTS11532
CTS4451
CTS4451
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies