Top » Catalog » SNPs » Y146181

$18.00

Y146181
[Y146181]

Y146181
hg38 Position: ChrY:9938565..9938565
Ancestral: C
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > Z33 > CTS7352
Forward Primer: Y146181_F TCTGCCTCCAGAGTTCAAGAC
Reverse Primer: Y146181_R ATAATGAGTAGATGTGGGTATGTCAATAG
Reviews

Customers who bought this product also purchased
BY31331
BY31331
Y146210
Y146210
CTS2658
CTS2658
CTS6867
CTS6867
BY31330
BY31330
Y146179
Y146179
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies