Top » Catalog » SNPs » Y146181

$18.00

Y146181
[Y146181]

Y146181
hg38 Position: ChrY:9938565..9938565
Ancestral: C
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > Z33 > CTS7352
Forward Primer: Y146181_F TCTGCCTCCAGAGTTCAAGAC
Reverse Primer: Y146181_R ATAATGAGTAGATGTGGGTATGTCAATAG
Reviews

Customers who bought this product also purchased
CTS3552
CTS3552
R1b-PH137 Segregation Panel
R1b-PH137 Segregation Panel
CTS10051
CTS10051
BY31331
BY31331
Y146210
Y146210
CTS2658
CTS2658
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies