Top » Catalog » SNPs » Y152276

$18.00

Y152276
[Y152276]

Y152276
hg38 Position: ChrY:8954647..8954647
Ancestral: T
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > Z33 > CTS7352
Forward Primer: Y152276_F CAGTGAGCTGAGATTGGGTG
Reverse Primer: Y152276_R GTAAGGTGCGCCTAAAATTCTAAC
Reviews

Customers who bought this product also purchased
BY31329
BY31329
PH137
PH137
BY194812
BY194812
CTS5636
CTS5636
BY31326
BY31326
F26162
F26162
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies