Top » Catalog » SNPs » Y152276

$18.00

Y152276
[Y152276]

Y152276
hg38 Position: ChrY:8954647..8954647
Ancestral: T
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > Z33 > CTS7352
Forward Primer: Y152276_F CAGTGAGCTGAGATTGGGTG
Reverse Primer: Y152276_R GTAAGGTGCGCCTAAAATTCTAAC
Reviews

Customers who bought this product also purchased
R1b-PH137 Segregation Panel
R1b-PH137 Segregation Panel
CTS10051
CTS10051
BY31331
BY31331
Y146181
Y146181
CTS2658
CTS2658
CTS6867
CTS6867
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies