Top » Catalog » SNPs » FGC14951

$18.00

FGC14951
[FGC14951]

FGC14951
hg38 Position: ChrY:7023057..7023057
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27 > L617
Forward Primer: FGC14951_F GCCATTGAACCATATTCTAAATGTG
Reverse Primer: FGC14951_R ACCCAGGTCTGTTATGGATGA
Reviews

Customers who bought this product also purchased
DF27
DF27
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
FGC31068
FGC31068
L617
L617
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies