Top » Catalog » SNPs » FGC90254

$18.00

FGC90254
[FGC90254]

FGC90254
hg38 Position: ChrY:6766959..6766959
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2019)
ISOGG Haplogroup: E1b
Comments: .
Forward Primer: FGC90254_F ACTGTTTTACAGCCAGGCCA
Reverse Primer: FGC90254_R CCACTTCACAATGACTAGGTAATAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies