Top » Catalog » SNPs » FGC90256

$18.00

FGC90256
[FGC90256]

FGC90256
hg38 Position: ChrY:19963749..19963749
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2019)
ISOGG Haplogroup: E1b
Comments: .
Forward Primer: FGC90256_F CTTATGGAAATAATAAAGCAGACCTG
Reverse Primer: FGC90256_R CTGTGGAATGTTGGATGTTCTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y163939
1 x FT24798
1 x FGC90540
1 x FGC90325
1 x YSC0000902
1 x HVR1
1 x FGC90256
$133.00
Haplogroup Info
Other products
Currencies