Top » Catalog » SNPs » Y163939

$18.00

Y163939
[Y163939]

Y163939
hg38 Position: ChrY:19960337..19960337
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y163939_F GAAAGCATTGAGGCCAGATG
Reverse Primer: Y163939_R TGGGTTATGGAAAACAGCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies