Top » Catalog » SNPs » YSC0000902

$18.00

YSC0000902
[YSC0000902]

YSC0000902
hg38 Position: ChrY:15742819..15742819
Ancestral: A
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J1
Comments: Found in a hg J-M267* 454 sequence
Forward Primer: YSC0000902_F TCCCCCGACCCCATG
Reverse Primer: YSC0000902_R CTCAAACAAATTTACAAGAAAAAAATCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies