Top » Catalog » SNPs » Z2573

$18.00

Z2573
[Z2573]

Z2573
hg38 Position: ChrY:19438178..19438178
Ancestral: T
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of DF27
Forward Primer: Z2573_F ACCAGAATTTGTGGGACACAG
Reverse Primer: Z2573_R TTCATGATGATATCCCCTTTATCAC
Reviews (1)

Customers who bought this product also purchased
BY156463
BY156463
Z381
Z381
FGC39546
FGC39546
YP4698
YP4698
FT37828
FT37828
DF96
DF96
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies