Top » Catalog » SNPs » Z2573

$18.00

Z2573
[Z2573]

Z2573
hg38 Position: ChrY:19438178..19438178
Ancestral: T
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of DF27
Forward Primer: Z2573_F ACCAGAATTTGTGGGACACAG
Reverse Primer: Z2573_R TTCATGATGATATCCCCTTTATCAC
Reviews (1)

Customers who bought this product also purchased
Y111390
Y111390
Z301
Z301
BY20173
BY20173
BY41289
BY41289
FGC22213
FGC22213
L48
L48
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies