Top » Catalog » SNPs » Z2573

$18.00

Z2573
[Z2573]

Z2573
hg38 Position: ChrY:19438178..19438178
Ancestral: T
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of DF27
Forward Primer: Z2573_F ACCAGAATTTGTGGGACACAG
Reverse Primer: Z2573_R TTCATGATGATATCCCCTTTATCAC
Reviews (1)

Customers who bought this product also purchased
BY190237
BY190237
A11619
A11619
BY148847
BY148847
BY152326
BY152326
A11625
A11625
BY129286
BY129286
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies