Top » Catalog » SNPs » CTS11532

$18.00

CTS11532
[CTS11532]

CTS11532
hg38 Position: ChrY:20991155..20991155
Ancestral: A
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > Z33 > CTS7352
Forward Primer: CTS11532_F GAGAAATTGGCTGCATGTTG
Reverse Primer: CTS11532_R GCCTTTTCAAGCCTTTCATG
Reviews

Customers who bought this product also purchased
A25057
A25057
CTS11533
CTS11533
BY31338
BY31338
Y146210
Y146210
CTS3552
CTS3552
R1b-PH137 Segregation Panel
R1b-PH137 Segregation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies