Top » Catalog » SNPs » CTS11532

$18.00

CTS11532
[CTS11532]

CTS11532
hg38 Position: ChrY:20991155..20991155
Ancestral: A
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b
Comments: Below L2 > L20 > Z33 > CTS7352
Forward Primer: CTS11532_F GAGAAATTGGCTGCATGTTG
Reverse Primer: CTS11532_R GCCTTTTCAAGCCTTTCATG
Reviews

Customers who bought this product also purchased
BY31330
BY31330
Y146179
Y146179
CTS1221
CTS1221
CTS6449
CTS6449
BY31329
BY31329
PH137
PH137
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies