Top » Catalog » SNPs » BY128975

$18.00

BY128975
[BY128975]

BY128975
hg38 Position: ChrY:17310892..17310892
Ancestral: A
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY128975_F CATCCACTGCAATACAGTCTGG
Reverse Primer: BY128975_R AAGTATCCATAATGGAAACATGAGTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies