Top » Catalog » SNPs » BY29108

$18.00

BY29108
[BY29108]

BY29108
hg38 Position: ChrY:15736063..15736063
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY29108_F CATTGTTCATTTCTTTATAATTCCTGC
Reverse Primer: BY29108_R CAAAATCTATTCTAAGACCCAACTGTC
Reviews

Customers who bought this product also purchased
BY39363
BY39363
A151
A151
BY16028
BY16028
A195
A195
BY3863
BY3863
BY39361
BY39361
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies