Top » Catalog » SNPs » BY29108

$18.00

BY29108
[BY29108]

BY29108
hg38 Position: ChrY:15736063..15736063
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY29108_F CATTGTTCATTTCTTTATAATTCCTGC
Reverse Primer: BY29108_R CAAAATCTATTCTAAGACCCAACTGTC
Reviews

Customers who bought this product also purchased
BY3863
BY3863
BY39361
BY39361
S1121
S1121
FT43021
FT43021
A1133
A1133
A541
A541
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies