Top » Catalog » SNPs » BY29108

$18.00

BY29108
[BY29108]

BY29108
hg38 Position: ChrY:15736063..15736063
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY29108_F CATTGTTCATTTCTTTATAATTCCTGC
Reverse Primer: BY29108_R CAAAATCTATTCTAAGACCCAACTGTC
Reviews

Customers who bought this product also purchased
FGC42469
FGC42469
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
A9005
A9005
BY39363
BY39363
A151
A151
BY16028
BY16028
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies