Top » Catalog » SNPs » BY29108

$18.00

BY29108
[BY29108]

BY29108
hg38 Position: ChrY:15736063..15736063
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY29108_F CATTGTTCATTTCTTTATAATTCCTGC
Reverse Primer: BY29108_R CAAAATCTATTCTAAGACCCAACTGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y15163
1 x A17940
1 x PH185
1 x Y20573
1 x Y13374
1 x A24023
1 x A24017
1 x FGC45021
1 x P244.2
1 x FGC32608
1 x HU202
1 x FGC6741
1 x FGC6750
1 x SK1392
1 x FT19636
1 x Y14572
1 x BY64505
1 x Y15041
1 x Y5169
1 x J2a-Y20307* Stirnimann Clan Segregation Panel
$445.00
Haplogroup Info
Other products
Currencies