Top » Catalog » SNPs » BY29109

$18.00

BY29109
[BY29109]

BY29109
hg38 Position: ChrY:9003901..9003901
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R
Comments: .
Forward Primer: BY29109_F ACTATATATCAATCCCTATGGGACCAG
Reverse Primer: BY29109_R AGGTTTGAGGAATTCTGCAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies