Top » Catalog » SNPs » FT43021

$18.00

FT43021
[FT43021]

FT43021
hg38 Position: ChrY:16270005..16270005
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT43021_F ACAATTCCCATGGGTTGTG
Reverse Primer: FT43021_R AGGGTAAAGAGGGTGAGTCATTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC47437
$18.00
Haplogroup Info
Other products
Currencies