Top » Catalog » SNPs » FT43021

$18.00

FT43021
[FT43021]

FT43021
hg38 Position: ChrY:16270005..16270005
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT43021_F ACAATTCCCATGGGTTGTG
Reverse Primer: FT43021_R AGGGTAAAGAGGGTGAGTCATTG
Reviews

Customers who bought this product also purchased
BY39364
BY39364
Z16521
Z16521
FGC29280
FGC29280
A1133
A1133
A541
A541
A159
A159
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies