Top » Catalog » SNPs » FT43021

$18.00

FT43021
[FT43021]

FT43021
hg38 Position: ChrY:16270005..16270005
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT43021_F ACAATTCCCATGGGTTGTG
Reverse Primer: FT43021_R AGGGTAAAGAGGGTGAGTCATTG
Reviews

Customers who bought this product also purchased
FGC29280
FGC29280
BY39364
BY39364
Z16521
Z16521
A151
A151
BY39363
BY39363
A195
A195
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies