Top » Catalog » SNPs » FT88142

$18.00

FT88142
[FT88142]

FT88142
hg38 Position: ChrY:18947398..18947398
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT88142_F GGGAAGAAATGACCGCAATAG
Reverse Primer: FT88142_R GGCATCAGATCCCATCACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A50
1 x A763
1 x A1094
1 x A2261
1 x A752
1 x A151
1 x A2262
1 x A541
1 x A386
1 x A161
1 x A455
1 x A968
1 x A45
1 x A254
$252.00
Haplogroup Info
Other products
Currencies