Top » Catalog » SNPs » FT88142

$18.00

FT88142
[FT88142]

FT88142
hg38 Position: ChrY:18947398..18947398
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT88142_F GGGAAGAAATGACCGCAATAG
Reverse Primer: FT88142_R GGCATCAGATCCCATCACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies