Top » Catalog » SNPs » ZS8376

$18.00

ZS8376
[ZS8376]

ZS8376
hg38 Position: ChrY:20759826..20759826
Ancestral: C
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream L93 > ZS1281
Forward Primer: ZS8376_F GGAAGAGCACACAGTCTGTGTTAAG
Reverse Primer: ZS8376_R CAAACTTCGATAACCACCAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies