Top » Catalog » SNPs » BY19601

$18.00

BY19601
[BY19601]

BY19601
hg38 Position: ChrY:14928189..14928189
Ancestral: A
Derived: G
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY19601_F CACAAACTTAACAGCTACAGCACC
Reverse Primer: BY19601_R AGATTATGAAGAAGACAATGCATATTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies