Top » Catalog » SNPs » BY141576

$18.00

BY141576
[BY141576]

BY141576
hg38 Position: ChrY:20742572..20742572
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: E
Comments: .
Forward Primer: BY141576_F CATTTTTGGCCAGGTGTG
Reverse Primer: BY141576_R TCATGTTTCTTGAGCATGTGG
Reviews

Customers who bought this product also purchased
Y15561
Y15561
Y134217
Y134217
E1b-Z834 Panel
E1b-Z834 Panel
BY165218
BY165218
B405
B405
Y15937
Y15937
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies