Top » Catalog » SNPs » M10667

$18.00

M10667
[M10667]

M10667
hg38 Position: ChrY:14792318..14792318
Ancestral: C
Derived: T
Reference: Underhill et al (2019)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: M10667_F GCAGGCCTTCAGTCATGG
Reverse Primer: M10667_R GTGGATTTCTGAATTGAGAAGTGG
Reviews

Customers who bought this product also purchased
BY4
BY4
FGC42781
FGC42781
M267
M267
FGC1695
FGC1695
FGC4422
FGC4422
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies