Top » Catalog » SNPs » M10667

$18.00

M10667
[M10667]

M10667
hg38 Position: ChrY:14792318..14792318
Ancestral: C
Derived: T
Reference: Underhill et al (2019)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: M10667_F GCAGGCCTTCAGTCATGG
Reverse Primer: M10667_R GTGGATTTCTGAATTGAGAAGTGG
Reviews

Customers who bought this product also purchased
FGC4421
FGC4421
M96
M96
BY4
BY4
FGC42781
FGC42781
M267
M267
FGC1695
FGC1695
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies